Advertisement

Mutation analysis of the TUBB8 gene in nine infertile women with oocyte maturation arrest

  • Author Footnotes
    1 These authors contributed equally to this work.
    Lingli Huang
    Footnotes
    1 These authors contributed equally to this work.
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Author Footnotes
    1 These authors contributed equally to this work.
    Xianhong Tong
    Footnotes
    1 These authors contributed equally to this work.
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Lihua Luo
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Shengxia Zheng
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Rentao Jin
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Yingyun Fu
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Guixiang Zhou
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Daojing Li
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Yusheng Liu
    Correspondence
    Corresponding author.
    Affiliations
    Center for Reproductive Medicine, Department of Obstetrics and Gynecology, Anhui Provincial Hospital Affiliated to Anhui Medical University, Hefei, 230001 Anhui, China
    Search for articles by this author
  • Author Footnotes
    1 These authors contributed equally to this work.

      Abstract

      Mutations in the tubulin beta 8 class VIII (TUBB8) gene have been proven to cause oocyte maturation arrest. The aim of this study was to describe newly discovered mutations in TUBB8 and to investigate the prevalence of TUBB8 mutations in our cohort. Nine women with oocyte maturation arrest and 100 fertile female controls were recruited. Sanger sequencing of the coding regions of TUBB8 revealed a heterozygous variant c.535G > A (p.V179M) in two unrelated affected individuals and a heterozygous variant c.5G > T (p.R2M) in one affected individual. These TUBB8 variants were inherited from the unaffected fathers and were absent in 100 fertile female control individuals. In total, 33.33% (3/9) of the affected individuals in our cohort obtained a clear genetic diagnosis through sequencing of the TUBB8 gene. These two novel variants extend the spectrum of TUBB8 mutations and this study confirmed that TUBB8 mutations occur in a high proportion of infertile women with oocyte maturation arrest.

      Keywords

      Introduction

      In most mammals, metaphase II (MII) is the only stage at which an oocyte can be successfully fertilized through fusing with a sperm cell to form a zygote (
      • Eppig J.J.
      Regulation of mammalian oocyte maturation.
      ,
      • Fulka Jr., J.
      • First N.L.
      • Moor R.M.
      Nuclear and cytoplasmic determinants involved in the regulation of mammalian oocyte maturation.
      ). Human oocytes are first arrested at prophase I and resume meiosis under the stimulation of LH surge (
      • Coticchio G.
      • Dal Canto M.
      • Mignini Renzini M.
      • Guglielmo M.C.
      • Brambillasca F.
      • Turchi D.
      • Novara P.V.
      • Fadini R.
      Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization.
      ,
      • Mehlmann L.M.
      Stops and starts in mammalian oocytes: recent advances in understanding the regulation of meiotic arrest and oocyte maturation.
      ). The maturation of the oocyte comprises meiosis from prophase I to MII and a series of morphological changes that are regulated by complex molecular pathways (
      • Kimura N.
      • Hoshino Y.
      • Totsukawa K.
      • Sato E.
      Cellular and molecular events during oocyte maturation in mammals: molecules of cumulus-oocyte complex matrix and signalling pathways regulating meiotic progression.
      ,
      • Matzuk M.M.
      • Lamb D.J.
      Genetic dissection of mammalian fertility pathways.
      ,
      • Schmitt A.
      • Nebreda A.R.
      Signalling pathways in oocyte meiotic maturation.
      ,
      • Vogt E.
      • Kirsch-Volders M.
      • Parry J.
      • Eichenlaub-Ritter U.
      Spindle formation, chromosome segregation and the spindle checkpoint in mammalian oocytes and susceptibility to meiotic error.
      ). Morphologically, oocytes at prophase I have an intact nucleus, termed the germinal vesicle (GV), and after GV breakdown the oocytes progress to metaphase I (MI). Following extrusion of a polar body and asymmetric division, MI is soon completed and the oocyte is again arrested at MII until fertilization (
      • Eppig J.J.
      Coordination of nuclear and cytoplasmic oocyte maturation in eutherian mammals.
      ). At the molecular level, there are several signalling pathways involved (
      • Choi T.
      • Fukasawa K.
      • Zhou R.
      • Tessarollo L.
      • Borror K.
      • Resau J.
      • Vande Woude G.F.
      The Mos/mitogen-activated protein kinase (MAPK) pathway regulates the size and degradation of the first polar body in maturing mouse oocytes.
      ,
      • Huo L.J.
      • Fan H.Y.
      • Zhong Z.S.
      • Chen D.Y.
      • Schatten H.
      • Sun Q.Y.
      Ubiquitin-proteasome pathway modulates mouse oocyte meiotic maturation and fertilization via regulation of MAPK cascade and cyclin B1 degradation.
      ,
      • Kang H.J.
      • Feng Z.
      • Sun Y.
      • Atwal G.
      • Murphy M.E.
      • Rebbeck T.R.
      • Rosenwaks Z.
      • Levine A.J.
      • Hu W.
      Single-nucleotide polymorphisms in the p53 pathway regulate fertility in humans.
      ,
      • Lee B.
      • Vermassen E.
      • Yoon S.Y.
      • Vanderheyden V.
      • Ito J.
      • Alfandari D.
      • De Smedt H.
      • Parys J.B.
      • Fissore R.A.
      Phosphorylation of IP3R1 and the regulation of [Ca2+]i responses at fertilization: a role for the MAP kinase pathway.
      ,
      • Takahashi T.
      • Morrow J.D.
      • Wang H.
      • Dey S.K.
      Cyclooxygenase-2-derived prostaglandin E(2) directs oocyte maturation by differentially influencing multiple signaling pathways.
      ). Numerous mouse models have linked several genes with oocyte maturation arrest (
      • Fan H.Y.
      • Liu Z.
      • Shimada M.
      • Sterneck E.
      • Johnson P.F.
      • Hedrick S.M.
      • Richards J.S.
      MAPK3/1 (ERK1/2) in ovarian granulosa cells are essential for female fertility.
      ,
      • Mehlmann L.M.
      • Jones T.L.
      • Jaffe L.A.
      Meiotic arrest in the mouse follicle maintained by a Gs protein in the oocyte.
      ,
      • Mehlmann L.M.
      • Saeki Y.
      • Tanaka S.
      • Brennan T.J.
      • Evsikov A.V.
      • Pendola F.L.
      • Knowles B.B.
      • Eppig J.J.
      • Jaffe L.A.
      The Gs-linked receptor GPR3 maintains meiotic arrest in mammalian oocytes.
      ,
      • Park J.Y.
      • Su Y.Q.
      • Ariga M.
      • Law E.
      • Jin S.L.
      • Conti M.
      EGF-like growth factors as mediators of LH action in the ovulatory follicle.
      ,
      • Zhang M.
      • Su Y.Q.
      • Sugiura K.
      • Xia G.
      • Eppig J.J.
      Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes.
      ). However, only a few cases of oocyte maturation arrest in women with primary infertility have been reported (
      • Bergere M.
      • Lombroso R.
      • Gombault M.
      • Wainer R.
      • Selva J.
      An idiopathic infertility with oocytes metaphase I maturation block: case report.
      ,
      • Eichenlaub-Ritter U.
      • Schmiady H.
      • Kentenich H.
      • Soewarto D.
      Recurrent failure in polar body formation and premature chromosome condensation in oocytes from a human patient: indicators of asynchrony in nuclear and cytoplasmic maturation.
      ,
      • Hartshorne G.
      • Montgomery S.
      • Klentzeris L.
      A case of failed oocyte maturation in vivo and in vitro.
      ,
      • Levran D.
      • Farhi J.
      • Nahum H.
      • Glezerman M.
      • Weissman A.
      Maturation arrest of human oocytes as a cause of infertility: case report.
      ,
      • Rudak E.
      • Dor J.
      • Kimchi M.
      • Goldman B.
      • Levran D.
      • Mashiach S.
      Anomalies of human oocytes from infertile women undergoing treatment by in vitro fertilization.
      ,
      • Schmiady H.
      • Neitzel H.
      Arrest of human oocytes during meiosis I in two sisters of consanguineous parents: first evidence for an autosomal recessive trait in human infertility: Case report.
      ); and little is known about the genetic basis of this condition.
      Recently, two studies (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ) identified that some cases of infertile women with oocyte maturation arrest were caused by heterozygous or homozygous mutations of the TUBB8 gene (MIM 616768) (
      • McKusick V.A.
      Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders.
      ). TUBB8 encodes a protein that is the primary beta-tubulin subunit of the oocyte and early embryo. TUBB8 heterozygous mutations, either paternally inherited or de novo, have dominant-negative effects that disrupt microtubule behaviour and oocyte meiotic spindle assembly, and thus arrest oocyte maturation (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ). So far, a total of 16 different mutations of the TUBB8 gene have been identified (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). Using immunostaining analysis, oocytes harbouring these TUBB8 mutations can show one of three distinct phenotypes: MI oocytes with an impaired spindle; MI oocytes that are dysfunctional but have a visible although morphologically defective spindle; or oocytes with MII morphology that either lack an identifiable spindle or contain an impaired spindle (
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). Through standard or polarizing light microscopy, oocytes with certain mutations (e.g. p.I210V, p.T238M, p. E27_A33del, p.T143Dfs*12) were observed to have a small proportion of morphologically identifiable MII oocytes with an extruding first polar body. These morphologically MII oocytes can be fertilized and cleave, but these embryos later become developmentally arrested (
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). Overall, different TUBB8 mutations can result in an extensive variety of oocyte phenotypes with respect to spindle morphology and extrusion of the first polar body.
      In the present study, we aimed to investigate the prevalence of both known and novel TUBB8 mutations in our cohort of infertile women with oocyte maturation arrest. We confirmed that TUBB8 gene mutations occur in a high proportion of infertile women with oocyte maturation arrest. We identified two novel mutations and discussed the possible effects on the function of the TUBB8 protein. These new findings broaden the mutation spectrum of TUBB8.

      Materials and methods

      Patient and control individuals

      Nine affected individuals diagnosed with oocyte maturation arrest were recruited from the Center for Reproductive Medicine, Anhui Provincial Hospital. All of them had a normal karyotype (46, XX). DNA samples were obtained from all nine affected individuals and all of their available family members. One hundred DNA samples of unrelated, anonymous, fertile women from the same population were used as controls. Written informed consent was obtained from every participant. This genetic investigation was approved by the biomedical research ethics committee of Anhui Medical University on 1 March 2014 (reference number 20140022).

      DNA extraction

      Genomic DNA was extracted from peripheral blood samples using the QIAamp DNA Blood Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer's protocol.

      Mutation screening

      All the coding regions of TUBB8 were amplified by PCR. Primers are shown in Table 1. PCR conditions were as follows: pre-denaturing at 94°C for 5 min, followed by 35 cycles of denaturing at 94°C for 30 s, annealing at 60°C for 30 s and extending at 72°C for 1 min, and final elongation at 72°C for 5 min. The PCR products were directly Sanger sequenced in both forward and reverse directions, using an ABI 3100 DNA analyser (Applied Biosystems, Foster City, CA, USA).
      Table 1Genomic PCR primers used to amplify TUBB8 exons for Sanger sequencing.
      ExonF/R
      F represents forward primers and R represents reverse primers.
      Primer sequence (5' to 3')PCR size (bp)
      1–3FCGGGGCTATTTAAACGTTGG805
      RCCCAGAGGATGACCTTAGCA
      4FGTGTGACGCTTGGCTCTTTC1266
      RTTAAAACGCAGCAGGAGATG
      bp, base pair.
      a F represents forward primers and R represents reverse primers.

      In-silico analysis of sequence variants

      Multiple sequence alignment of the human TUBB8 protein with its orthologues was performed using MultiAlin (
      • Corpet F.
      Multiple sequence alignment with hierarchical clustering.
      ). The pathogenicity of the identified variants on the TUBB8 protein was assessed using SIFT (
      • Sim N.L.
      • Kumar P.
      • Hu J.
      • Henikoff S.
      • Schneider G.
      • Ng P.C.
      SIFT web server: predicting effects of amino acid substitutions on proteins.
      ) and PolyPhen 2 (
      • Adzhubei I.A.
      • Schmidt S.
      • Peshkin L.
      • Ramensky V.E.
      • Gerasimova A.
      • Bork P.
      • Kondrashov A.S.
      • Sunyaev S.R.
      A method and server for predicting damaging missense mutation.
      ). dbSNP (v142) and the Exome Aggregation Consortium (ExAC) browser (
      • Lek M.
      • Karczewski K.J.
      • Minikel E.V.
      • Samocha K.E.
      • Banks E.
      • Fennell T.
      • O'Donnell-Luria A.H.
      • Ware J.S.
      • Hill A.J.
      • Cummings B.B.
      • Tukiainen T.
      • Birnbaum D.P.
      • Kosmicki J.A.
      • Duncan L.E.
      • Estrada K.
      • Zhao F.
      • Zou J.
      • Pierce-Hoffman E.
      • Berghout J.
      • Cooper D.N.
      • Deflaux N.
      • DePristo M.
      • Do R.
      • Flannick J.
      • Fromer M.
      • Gauthier L.
      • Goldstein J.
      • Gupta N.
      • Howrigan D.
      • Kiezun A.
      • Kurki M.I.
      • Moonshine A.L.
      • Natarajan P.
      • Orozco L.
      • Peloso G.M.
      • Poplin R.
      • Rivas M.A.
      • Ruano-Rubio V.
      • Rose S.A.
      • Ruderfer D.M.
      • Shakir K.
      • Stenson P.D.
      • Stevens C.
      • Thomas B.P.
      • Tiao G.
      • Tusie-Luna M.T.
      • Weisburd B.
      • Won H.H.
      • Yu D.
      • Altshuler D.M.
      • Ardissino D.
      • Boehnke M.
      • Danesh J.
      • Donnelly S.
      • Elosua R.
      • Florez J.C.
      • Gabriel S.B.
      • Getz G.
      • Glatt S.J.
      • Hultman C.M.
      • Kathiresan S.
      • Laakso M.
      • McCarroll S.
      • McCarthy M.I.
      • McGovern D.
      • McPherson R.
      • Neale B.M.
      • Palotie A.
      • Purcell S.M.
      • Saleheen D.
      • Scharf J.M.
      • Sklar P.
      • Sullivan P.F.
      • Tuomilehto J.
      • Tsuang M.T.
      • Watkins H.C.
      • Wilson J.G.
      • Daly M.J.
      • MacArthur D.G.
      Exome Aggregation Consortium
      Analysis of protein-coding genetic variation in 60,706 humans.
      ) were used to search the allele frequencies of the variants.

      Results

      Attempted intracytoplasmic sperm injection (ICSI) in patient II-1 from family 1 resulted in oocytes that were all in MI (Figure 1A); none of which were fertilized (Table 2). In patient II-2 from family 2, oocytes failed to mature (Figure 1A) even after extended culture in vitro and fertilization after ICSI failed. These two unrelated affected individuals were found to be heterozygous for a missense variant NM_177987.2 (TUBB8): c.535G > A (p.Val179Met) (Figure 2A). Both of these two individuals were from non-consanguineous families. In both cases, the variant was paternally inherited.
      Figure 1
      Figure 1(A) The morphology of a mature (MII) oocyte from a normal individual and immature (MI) oocytes from patients in families 1, 2 and 3. (B) The morphology of a normal fertilized oocyte with two pronuclei from a normal individual and fertilized oocytes with three pronuclei (left) and one pronucleus (right) from the patient in family 3. The morphologies of oocytes were examined by light microscopy. Scale bars in A and B: 50 µm. MI = metaphase I; MII = metaphase II.
      Table 2Oocyte and embryo characteristics of IVF and ICSI attempts for three affected individuals.
      CaseMutationAgeDuration of infertility (years)Previous IVF/ICSI cyclesTotal no. of oocytes retrievedStages of oocytesFertilization and embryo development
      Family 1, Patient II-1p.V179M27522424 in MI-
      Family 2, Patient II-2p.V179M29634646 in MI-
      Family 3, Patient II-1p.R2M27322121 in MIAbnormal fertilization in three oocytes (after IVF) but with no cleavage
      ICSI, intracytoplasmic sperm injection; MI, metaphase I.
      Figure 2
      Figure 2(A) Pedigree analysis of three unrelated families and chromatograms showing part of TUBB8 in family members. The arrows indicate the positions of the variants. (B) Amino acid sequence alignment of TUBB8 protein in different species. The amino acids in positions 2 and 179 are highlighted by a dashed box.
      In patient II-1 from family 3, attempted IVF was performed and all oocytes were found to be in MI (Figure 1A) during preparation for early rescue ICSI. Three oocytes (two with one pronucleus and one with three pronuclei) had extruded one or two polar bodies after IVF on day 1 (Figure 1B) but no cleavage was observed on day 3 (Table 2). This patient was also from a non-consanguineous family and was found to be heterozygous for a paternally inherited missense variant NM_177987.2 (TUBB8): c.5G > T (p.Arg2Met) (Figure 2A).
      The amino acids in positions p.V179 and p.R2 are highly conserved based on analysis with MultiAlin (Figure 2B). The two novel variants were predicted to be highly damaging to the function of the TUBB8 protein, by SIFT and PolyPhen 2 (Table 3).
      Table 3Effects of TUBB8 mutations, predicted with in-silico tools.
      cDNA alterationAmino acid alterationExonFrequency in our cohortdbSNPExAC allele frequencyExAC homozygotes frequencySIFTPolyPhen 2
      c.535G > Ap. V179M42/9Not found1/120158Not found0.00 (D)
      D = deleterious; ExAC = Exome Aggregation Consortium.
      1.0 (D)
      c.5G > Tp. R2M11/9Not foundNot foundNot found0.00 (D)1.0 (D)
      a D = deleterious; ExAC = Exome Aggregation Consortium.
      To exclude the possibility that the identified variants may be common in the studied population, we performed Sanger sequencing of TUBB8 in 100 unrelated fertile women. The above two variants were absent in all of the 100 control DNA samples and not recorded in dbSNP (v142). In addition, inspection of the ExAC browser identified that c.535G > A has a low allele frequency (1/120158), indicating that c.535G > A was found in a single individual with unknown gender and only in the heterozygous state. The c.5G > T variant was not found in the ExAC browser.

      Discussion

      The genetic analysis of a cohort of nine infertile women with oocyte maturation defects allowed us to define the prevalence of TUBB8 mutations in that cohort. All four exons of TUBB8 can be amplified and Sanger sequenced using only two pairs of primers, thus it is quite feasible and not expensive for genetic diagnosis. In total, three out of nine unrelated affected individuals (33.33%) were genetically diagnosed with heterozygous TUBB8 mutations. A previous study showed that 29.17% (7/24) of infertile women with an oocyte maturation defect had TUBB8 mutations (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ), which was followed by a second study that estimated a higher prevalence (37.2%) of TUBB8 mutations in 43 subjects when taking the two cohorts together (
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). The difference may be due to a bias in patient recruitment or a limited number of patients analysed in all studies to date. Nevertheless, our study independently confirms that a high proportion of defects of oocyte maturation in infertile women are indeed caused by molecular defects of TUBB8. It is recommended that TUBB8 should be preferentially analysed as part of the genetic diagnosis of infertile women with oocyte maturation arrest.
      Two previous studies identified 16 different mutations in TUBB8, including 13 heterozygous mutations (p.R2K, p.S176L, p.I210V, p.V229A, p.T238M, p.V255M, p.R262Q, p.R262W, p.T285P, p.M300I, p.N348S, p.M363T and p.D417N) and two homozygous mutations (p.E27_A33del and p.T143Dfs*12) (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ) (Table 4). Here, we report two additional novel mutations of TUBB8, which further expand the mutation spectrum of TUBB8. One heterozygous mutation (p.V179M) was identified in two unrelated patients and the other heterozygous mutation (p.R2M) was found in an additional patient. The amino acid positions of these two mutations were highly conserved and these two mutations were predicted to be deleterious with in-silico tools. The p.V179 residue lies in the beta:T5 loop and is located at a longitudinal interface between assembled alpha/beta-tubulin heterodimer; its substitution may disrupt the longitudinal interactions, thus affecting microtubule assembly. The p.R2 residue is located at the alpha/beta-tubulin interface within the heterodimer and the mutation p.R2M could influence dimer assembly and stability (
      • Zhang R.
      • Alushin G.M.
      • Brown A.
      • Nogales E.
      Mechanistic origin of microtubule dynamic instability and its modulation by EB proteins.
      ). Previous studies proved that most pathogenic missense TUBB8 mutations would result in impaired microtubule behaviour and impaired oocyte meiotic spindle assembly by dominant-negative effects (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). Immunostaining analysis of oocytes from the affected individuals may help to evaluate whether these two newly discovered TUBB8 mutations cause oocyte maturation arrest through the same pathogenic mechanism. However, no oocytes of the affected individuals in this study were available for experimental purposes.
      Table 4Summary of reported TUBB8 mutations.
      cDNA alterationAmino acid alterationExonHetero-/homo-References
      c.5G > Ap.R2K1Hetero-
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      c.527C > T
      Reported both by Feng et al. (2016a) and Feng et al. (2016b).
      p.S176L4Hetero-
      c.686T > Cp.V229A4Hetero-
      c.785G > Ap.R262Q4Hetero-
      c.900G > Ap.M300I4Hetero-
      c.1088T > Cp.M363T4Hetero-
      c.1249G > Ap.D417N4Hetero-
      c.628A > Gp.I210V4Hetero-
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      c.713C > Tp.T238M4Hetero-
      c.763G > Ap.V255M4Hetero-
      c.784C > Tp.R262W4Hetero-
      c.853A > Cp.T285P4Hetero-
      c.1043A > Gp.N348S4Hetero-
      c.80_100delp.E27_A33del2Homo-
      c.426_427insGp.T143Dfs*124Homo-
      a Reported both by
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      and
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      .
      Previous studies showed that some of the oocytes (with p.I210V, p.T238M or p.N348S mutations) that were morphologically recognizable as MII can be fertilized and even cleave, but these embryos later become developmentally arrested (Table 4) (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). In the routine use of clinical ICSI, only morphological MII oocytes identified by light microscopy are selected for fertilization. In this study, oocytes with the p.R2M mutation were only found to be in MI, thus the procedure of early rescue ICSI was not performed; three out of 21 oocytes became abnormally fertilized after IVF on day 1, but no cleavage was observed on day 3. After oocyte denudation and additional incubation with spermatozoa overnight, some oocytes can be further matured and inseminated (
      • Lacham-Kaplan O.
      • Trounson A.
      Reduced developmental competence of immature, in-vitro matured and postovulatory aged mouse oocytes following IVF and ICSI.
      ). In this way, it is possible that a small proportion of oocytes with p.R2M could extrude the first polar body (PB1). This phenotype was reported in cases with some TUBB8 mutations in a previous study (
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ). Even with an impaired spindle, these in-vitro maturated MII oocytes still have an opportunity to be fertilized by spermatozoa in an incubator overnight, but a polynucleated cytoplasm could be observed due to the blocked extrusion of the second polar body. A single pronucleus could also be formed due to a decreased ability to induce sperm decondensation in these oocytes with incomplete cytoplasmic maturation (
      • Lacham-Kaplan O.
      • Trounson A.
      Reduced developmental competence of immature, in-vitro matured and postovulatory aged mouse oocytes following IVF and ICSI.
      ). Although oocytes with some TUBB8 mutations can mature to MII oocytes (
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ), the proportion of these morphologically mature oocytes of total retrieved oocytes may vary in different conditions (e.g. triggering final follicular maturation with human chorionic gonadotrophin (HCG), gonadotrophin-releasing hormone agonists (GnRHa), or both, and the timing of triggering (
      • Griffin D.
      • Feinn R.
      • Engmann L.
      • Nulsen J.
      • Budinetz T.
      • Benadiva C.
      Dual trigger with gonadotropin-releasing hormone agonist and standard dose human chorionic gonadotropin to improve oocyte maturity rates.
      )). Our study assumed that a small proportion of oocytes with some TUBB8 mutations could extrude the PB1 after in-vitro maturation (not only after the normal routine of oocyte retrieval) and could be fertilized by IVF, but that the ensuing embryos would become arrested at an early stage of development.
      The fathers in two unrelated families that carried the TUBB8 c.535G > A mutation were fertile. The ExAC browser revealed that c.535G > A had a low allele frequency (1/120158). In fact, it is possible that the prevalence of fertile males with heterozygous TUBB8 mutations could be underestimated. This could be one of the underlying factors for the high proportion of TUBB8 mutations in infertile women with oocyte maturation arrest.
      There were 66.67% (6/9) of the affected individuals in our cohort with no TUBB8 mutations. This indicates that human oocyte maturation arrest can also be caused by defects of other genes that are yet to be implicated in this disorder. However, our data in combination with two previous studies (
      • Feng R.
      • Sang Q.
      • Kuang Y.
      • Sun X.
      • Yan Z.
      • Zhang S.
      • Shi J.
      • Tian G.
      • Luchniak A.
      • Fukuda Y.
      • Li B.
      • Yu M.
      • Chen J.
      • Xu Y.
      • Guo L.
      • Qu R.
      • Wang X.
      • Sun Z.
      • Liu M.
      • Shi H.
      • Wang H.
      • Feng Y.
      • Shao R.
      • Chai R.
      • Li Q.
      • Xing Q.
      • Zhang R.
      • Nogales E.
      • Jin L.
      • He L.
      • Gupta Jr., M.L.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
      ,
      • Feng R.
      • Yan Z.
      • Li B.
      • Yu M.
      • Sang Q.
      • Tian G.
      • Xu Y.
      • Chen B.
      • Qu R.
      • Sun Z.
      • Sun X.
      • Jin L.
      • He L.
      • Kuang Y.
      • Cowan N.J.
      • Wang L.
      Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
      ) suggest that between 29.17% and 37.20% of patients with oocyte maturation arrest may obtain a genetic diagnosis through genetic screening of the TUBB8 gene. The presence of a TUBB8 mutation will probably confirm the diagnosis of oocyte maturation arrest and assign a poor prognosis for the success of assisted reproductive treatment.

      Acknowledgements

      We would like to thank all families and controls for participating in this study. This study was supported by the National Natural Science Foundation of China ( 81370757 to Y.L.) and the Central Guided Local Development of Science and Technology Special Fund (2016080802D114 to X.T.).

      References

        • Adzhubei I.A.
        • Schmidt S.
        • Peshkin L.
        • Ramensky V.E.
        • Gerasimova A.
        • Bork P.
        • Kondrashov A.S.
        • Sunyaev S.R.
        A method and server for predicting damaging missense mutation.
        Nat. Methods. 2010; 7: 248-249
        • Bergere M.
        • Lombroso R.
        • Gombault M.
        • Wainer R.
        • Selva J.
        An idiopathic infertility with oocytes metaphase I maturation block: case report.
        Hum. Reprod. 2001; 16: 2136-2138
        • Choi T.
        • Fukasawa K.
        • Zhou R.
        • Tessarollo L.
        • Borror K.
        • Resau J.
        • Vande Woude G.F.
        The Mos/mitogen-activated protein kinase (MAPK) pathway regulates the size and degradation of the first polar body in maturing mouse oocytes.
        Proc. Natl. Acad. Sci. U.S.A. 1996; 93: 7032-7035
        • Corpet F.
        Multiple sequence alignment with hierarchical clustering.
        Nucl. Acids Res. 1988; 16: 10881-10890
        • Coticchio G.
        • Dal Canto M.
        • Mignini Renzini M.
        • Guglielmo M.C.
        • Brambillasca F.
        • Turchi D.
        • Novara P.V.
        • Fadini R.
        Oocyte maturation: gamete-somatic cells interactions, meiotic resumption, cytoskeletal dynamics and cytoplasmic reorganization.
        Hum. Reprod. Update. 2015; 21: 427-454
        • Eichenlaub-Ritter U.
        • Schmiady H.
        • Kentenich H.
        • Soewarto D.
        Recurrent failure in polar body formation and premature chromosome condensation in oocytes from a human patient: indicators of asynchrony in nuclear and cytoplasmic maturation.
        Hum. Reprod. 1995; 10: 2343-2349
        • Eppig J.J.
        Regulation of mammalian oocyte maturation.
        in: Adashi E.Y. Leung P.C.K. The Ovary. Raven Press, New York1993: 185-208
        • Eppig J.J.
        Coordination of nuclear and cytoplasmic oocyte maturation in eutherian mammals.
        Reprod. Fertil. Dev. 1996; 8: 485-489
        • Fan H.Y.
        • Liu Z.
        • Shimada M.
        • Sterneck E.
        • Johnson P.F.
        • Hedrick S.M.
        • Richards J.S.
        MAPK3/1 (ERK1/2) in ovarian granulosa cells are essential for female fertility.
        Science. 2009; 324: 938-941
        • Feng R.
        • Sang Q.
        • Kuang Y.
        • Sun X.
        • Yan Z.
        • Zhang S.
        • Shi J.
        • Tian G.
        • Luchniak A.
        • Fukuda Y.
        • Li B.
        • Yu M.
        • Chen J.
        • Xu Y.
        • Guo L.
        • Qu R.
        • Wang X.
        • Sun Z.
        • Liu M.
        • Shi H.
        • Wang H.
        • Feng Y.
        • Shao R.
        • Chai R.
        • Li Q.
        • Xing Q.
        • Zhang R.
        • Nogales E.
        • Jin L.
        • He L.
        • Gupta Jr., M.L.
        • Cowan N.J.
        • Wang L.
        Mutations in TUBB8 and Human Oocyte Meiotic Arrest.
        N. Engl. J. Med. 2016; 374: 223-232
        • Feng R.
        • Yan Z.
        • Li B.
        • Yu M.
        • Sang Q.
        • Tian G.
        • Xu Y.
        • Chen B.
        • Qu R.
        • Sun Z.
        • Sun X.
        • Jin L.
        • He L.
        • Kuang Y.
        • Cowan N.J.
        • Wang L.
        Mutations in TUBB8 cause a multiplicity of phenotypes in human oocytes and early embryos.
        J. Med. Genet. 2016; 53: 662-671
        • Fulka Jr., J.
        • First N.L.
        • Moor R.M.
        Nuclear and cytoplasmic determinants involved in the regulation of mammalian oocyte maturation.
        Mol. Hum. Reprod. 1998; 4: 41-49
        • Griffin D.
        • Feinn R.
        • Engmann L.
        • Nulsen J.
        • Budinetz T.
        • Benadiva C.
        Dual trigger with gonadotropin-releasing hormone agonist and standard dose human chorionic gonadotropin to improve oocyte maturity rates.
        Fertil. Steril. 2014; 102: 405-409
        • Hartshorne G.
        • Montgomery S.
        • Klentzeris L.
        A case of failed oocyte maturation in vivo and in vitro.
        Fertil. Steril. 1999; 71: 567-570
        • Huo L.J.
        • Fan H.Y.
        • Zhong Z.S.
        • Chen D.Y.
        • Schatten H.
        • Sun Q.Y.
        Ubiquitin-proteasome pathway modulates mouse oocyte meiotic maturation and fertilization via regulation of MAPK cascade and cyclin B1 degradation.
        Mech. Dev. 2004; 121: 1275-1287
        • Kang H.J.
        • Feng Z.
        • Sun Y.
        • Atwal G.
        • Murphy M.E.
        • Rebbeck T.R.
        • Rosenwaks Z.
        • Levine A.J.
        • Hu W.
        Single-nucleotide polymorphisms in the p53 pathway regulate fertility in humans.
        Proc. Natl. Acad. Sci. U.S.A. 2009; 106: 9761-9766
        • Kimura N.
        • Hoshino Y.
        • Totsukawa K.
        • Sato E.
        Cellular and molecular events during oocyte maturation in mammals: molecules of cumulus-oocyte complex matrix and signalling pathways regulating meiotic progression.
        Soc. Reprod. Fertil. Suppl. 2007; 63: 327-342
        • Lacham-Kaplan O.
        • Trounson A.
        Reduced developmental competence of immature, in-vitro matured and postovulatory aged mouse oocytes following IVF and ICSI.
        Reprod. Biol. Endocrinol. 2008; 6: 58
        • Lee B.
        • Vermassen E.
        • Yoon S.Y.
        • Vanderheyden V.
        • Ito J.
        • Alfandari D.
        • De Smedt H.
        • Parys J.B.
        • Fissore R.A.
        Phosphorylation of IP3R1 and the regulation of [Ca2+]i responses at fertilization: a role for the MAP kinase pathway.
        Development. 2006; 133: 4355-4365
        • Lek M.
        • Karczewski K.J.
        • Minikel E.V.
        • Samocha K.E.
        • Banks E.
        • Fennell T.
        • O'Donnell-Luria A.H.
        • Ware J.S.
        • Hill A.J.
        • Cummings B.B.
        • Tukiainen T.
        • Birnbaum D.P.
        • Kosmicki J.A.
        • Duncan L.E.
        • Estrada K.
        • Zhao F.
        • Zou J.
        • Pierce-Hoffman E.
        • Berghout J.
        • Cooper D.N.
        • Deflaux N.
        • DePristo M.
        • Do R.
        • Flannick J.
        • Fromer M.
        • Gauthier L.
        • Goldstein J.
        • Gupta N.
        • Howrigan D.
        • Kiezun A.
        • Kurki M.I.
        • Moonshine A.L.
        • Natarajan P.
        • Orozco L.
        • Peloso G.M.
        • Poplin R.
        • Rivas M.A.
        • Ruano-Rubio V.
        • Rose S.A.
        • Ruderfer D.M.
        • Shakir K.
        • Stenson P.D.
        • Stevens C.
        • Thomas B.P.
        • Tiao G.
        • Tusie-Luna M.T.
        • Weisburd B.
        • Won H.H.
        • Yu D.
        • Altshuler D.M.
        • Ardissino D.
        • Boehnke M.
        • Danesh J.
        • Donnelly S.
        • Elosua R.
        • Florez J.C.
        • Gabriel S.B.
        • Getz G.
        • Glatt S.J.
        • Hultman C.M.
        • Kathiresan S.
        • Laakso M.
        • McCarroll S.
        • McCarthy M.I.
        • McGovern D.
        • McPherson R.
        • Neale B.M.
        • Palotie A.
        • Purcell S.M.
        • Saleheen D.
        • Scharf J.M.
        • Sklar P.
        • Sullivan P.F.
        • Tuomilehto J.
        • Tsuang M.T.
        • Watkins H.C.
        • Wilson J.G.
        • Daly M.J.
        • MacArthur D.G.
        • Exome Aggregation Consortium
        Analysis of protein-coding genetic variation in 60,706 humans.
        Nature. 2016; 536: 285-291
        • Levran D.
        • Farhi J.
        • Nahum H.
        • Glezerman M.
        • Weissman A.
        Maturation arrest of human oocytes as a cause of infertility: case report.
        Hum. Reprod. 2002; 17: 1604-1609
        • Matzuk M.M.
        • Lamb D.J.
        Genetic dissection of mammalian fertility pathways.
        Nat. Cell Biol. 2002; 4: s41-s49
        • McKusick V.A.
        Mendelian Inheritance in Man. A Catalog of Human Genes and Genetic Disorders.
        12th ed. Johns Hopkins University Press, Baltimore1998
        • Mehlmann L.M.
        Stops and starts in mammalian oocytes: recent advances in understanding the regulation of meiotic arrest and oocyte maturation.
        Reproduction. 2005; 130: 791-799
        • Mehlmann L.M.
        • Jones T.L.
        • Jaffe L.A.
        Meiotic arrest in the mouse follicle maintained by a Gs protein in the oocyte.
        Science. 2002; 297: 1343-1345
        • Mehlmann L.M.
        • Saeki Y.
        • Tanaka S.
        • Brennan T.J.
        • Evsikov A.V.
        • Pendola F.L.
        • Knowles B.B.
        • Eppig J.J.
        • Jaffe L.A.
        The Gs-linked receptor GPR3 maintains meiotic arrest in mammalian oocytes.
        Science. 2004; 306: 1947-1950
        • Park J.Y.
        • Su Y.Q.
        • Ariga M.
        • Law E.
        • Jin S.L.
        • Conti M.
        EGF-like growth factors as mediators of LH action in the ovulatory follicle.
        Science. 2004; 303: 682-684
        • Rudak E.
        • Dor J.
        • Kimchi M.
        • Goldman B.
        • Levran D.
        • Mashiach S.
        Anomalies of human oocytes from infertile women undergoing treatment by in vitro fertilization.
        Fertil. Steril. 1990; 54: 292-296
        • Schmiady H.
        • Neitzel H.
        Arrest of human oocytes during meiosis I in two sisters of consanguineous parents: first evidence for an autosomal recessive trait in human infertility: Case report.
        Hum. Reprod. 2002; 17: 2556-2559
        • Schmitt A.
        • Nebreda A.R.
        Signalling pathways in oocyte meiotic maturation.
        J. Cell Sci. 2002; 115: 2457-2459
        • Sim N.L.
        • Kumar P.
        • Hu J.
        • Henikoff S.
        • Schneider G.
        • Ng P.C.
        SIFT web server: predicting effects of amino acid substitutions on proteins.
        Nucl. Acids Res. 2012; 40: W542-W547
        • Takahashi T.
        • Morrow J.D.
        • Wang H.
        • Dey S.K.
        Cyclooxygenase-2-derived prostaglandin E(2) directs oocyte maturation by differentially influencing multiple signaling pathways.
        J. Biol. Chem. 2006; 281: 37117-37129
        • Vogt E.
        • Kirsch-Volders M.
        • Parry J.
        • Eichenlaub-Ritter U.
        Spindle formation, chromosome segregation and the spindle checkpoint in mammalian oocytes and susceptibility to meiotic error.
        Mutat. Res. 2008; 651: 14-29
        • Zhang M.
        • Su Y.Q.
        • Sugiura K.
        • Xia G.
        • Eppig J.J.
        Granulosa cell ligand NPPC and its receptor NPR2 maintain meiotic arrest in mouse oocytes.
        Science. 2010; 330: 366-369
        • Zhang R.
        • Alushin G.M.
        • Brown A.
        • Nogales E.
        Mechanistic origin of microtubule dynamic instability and its modulation by EB proteins.
        Cell. 2015; 162: 849-859

      Biography

      Dr Lingli Huang received her MD in 2008 and PhD in 2012 from Central South University. She works at the Reproductive Medicine Center in Anhui Provincial Hospital Affiliated to Anhui Medical University. Her main focus is on reproductive endocrinology and genetic diseases, follicle monitoring, IVF puncture, embryo transfer and genetic counselling.
      Key message
      Two new heterozygous TUBB8 gene mutations, p.R2M and p.V179M, were identified in three infertile women out of nine women with oocyte maturation arrest, expanding the spectrum of TUBB8 mutations and confirming TUBB8 mutations in a high proportion of infertile women with this condition.