Advertisement

METTL3 and METTL14-mediated N6-methyladenosine modification promotes cell proliferation and invasion in endometriosis

  • Licong Shen
    Affiliations
    Department of Gynecology, Xiangya Hospital, Central South University, No. 87 Xiangya Road, Changsha, 410008, P. R. China

    National Clinical Research Center of Geriatric Disorders, Xiangya Hospital, Central South University, Changsha, 410008, P. R. China
    Search for articles by this author
  • Chun Zhang
    Affiliations
    Department of Gynecology, Xiangya Hospital, Central South University, No. 87 Xiangya Road, Changsha, 410008, P. R. China
    Search for articles by this author
  • Yi Zhang
    Affiliations
    Department of Gynecology, Xiangya Hospital, Central South University, No. 87 Xiangya Road, Changsha, 410008, P. R. China

    National Clinical Research Center of Geriatric Disorders, Xiangya Hospital, Central South University, Changsha, 410008, P. R. China
    Search for articles by this author
  • Yongwen Yang
    Correspondence
    Corresponding address: Yongwen Yang, Department of Clinical Laboratory, Xiangya Hospital, Central South University, No. 87 Xiangya Road, Changsha, 410008, P. R. China. Tel:86-13687363380; Fax:86-0731-89757108.
    Affiliations
    Department of Clinical Laboratory, Xiangya Hospital, Central South University, No. 87 Xiangya Road, Changsha, 410008, P. R. China
    Search for articles by this author
Open AccessPublished:October 28, 2022DOI:https://doi.org/10.1016/j.rbmo.2022.10.010

      Abstract

      Research question

      Could METTL3 and METTL14-mediated N6-methyladenosine modification play possible cooperative roles in pathogenesis and progression of endometriosis?

      Design

      We aimed to investigate the m6A methylation profiles and the roles of METTL3 and METTL14 in the m6A regulation and pathogenesis of endometriosis. The m6A methylation and mRNA levels in paired ectopic endometrium (EC) and eutopic endometrium (EU) were measured using m6A–mRNA epitranscriptomic microarrays. The functions of m6A methylation in mRNAs were predicted using bioinformatics analysis. The levels of m6A writers were detected using qPCR. The role of METTL3 and METTL14 in endometriosis was explored using EU stromal cells.

      Results

      The m6A methylation levels were decreased in 1,312 mRNAs and increased in 518 mRNAs, and 1,797 mRNAs were increased and 2,580 mRNAs were reduced in the EC compared with the EU. Pathway analysis found that the genes with hypo-methylated m6A were significantly associated with important pathways in endometriosis, including estrogen, Hippo, and PI3K–Akt signaling and cell–cell adhesion. Furthermore, METTL3 and METTL14 were downregulated in the EC compared with the EU. METTL3 and METTL14 knockdown caused cell proliferation and invasion.

      Conclusion

      Taken together, these data reveal a differential m6A epitranscriptomic pattern in endometriosis; and the reduction of METTL3 and METTL14 expression indicates its role in endometriosis pathogenesis and progression. Thus, METTL3 and METTL14 may be a novel treatment target of the disease.

      Keywords

      INTRODUCTION

      Endometriosis is a common gynecological disorder defined by the presence of a functional endometrium outside of the uterine cavity. Up to 10% of women of reproductive age suffer from endometriosis; the incidence rate is rising over time (Eisenberg et al., 2018; Taylor et al., 2021). Endometriosis affects women's quality of life and family harmony because of pelvic pain, pelvic lumps, low fertility, high treatment cost, and unsatisfactory long-term treatment effect (Eisenberg et al., 2018; Taylor et al., 2021). The pathogenesis of endometriosis is complicated, and the underlying mechanisms remain to be clarified. Though the retrograde menstruation theory has been widely accepted for the onset of endometriosis, there is discrepancy between the high rate of retrograde menstruation and the low disease incidence (Wang et al., 2020). Thus, there is research on other mechanisms, including dysregulation of local estrogen production, immune dysfunction, and genetic and epigenetic factors, that may help explain the phenomenon (Wang et al., 2020).
      The post-transcriptional modifications of RNA, one of the most important epigenetic mechanisms regulating gene expression, affect protein production and generate different phenotypes (Liu et al., 2021). For example, N6-methyladenosine (m6A) modification, the most prevalent post-transcriptional modification, regulates the fate decisions of m6A-containing mRNAs via RNA splicing, destabilization, degradation, and translation (Fu et al., 2014; Wang et al., 2014;Wang et al., 2015; Zaccara et al., 2019). The level of m6A modification varies in DNA damage, cell proliferation, and differentiation (Liu et al., 2022; Jiang et al., 2021). Research has revealed the important functions of m6A in multiple biological processes, including cancer and organ development (Liu et al., 2022; Livneh et al., 2020; Wiener and Schwartz, 2021). The levels of m6A modification in biological processes are primarily determined by three types of enzymes, methyltransferases (also called writers), demethylases (erasers), and binding proteins (readers) (Yang et al., 2018; Wiener and Schwartz, 2021). The m6A writers comprise methyltransferase that catalyzes m6A modification on RNAs, including methyltransferase Like 3 (METTL3), METTL14, KIAA1429, Wilms Tumor 1 Associated Protein (WTAP), RNA Binding Motif Protein 15 (RBM15), and RBM15B. Abnormal activities of m6A writers affect m6A modification levels, leading to aberrant gene expression and protein synthesis (Fu et al., 2014). METTL3 plays a critical role in m6A catalytic process, and METTL14 acts as a coactivator during m6A deposition on nuclear RNAs which increases catalytic efficacy (Jiang et al., 2021). The dysregulation of METTL3/METTL14 complex exerts a significant effect on immune responses and cancer progression (Jiang et al., 2020; Huang et al., 2021). Moreover, METTL3/METTL14 deficiencies have been reported to be correlated with the cell functions in tumor growth and immunosurveillance (Dong et al., 2021; Liu et al., 2021).
      Despite the substantial progress in disease research, the METTL3/METTL14 regulatory patterns and potential roles of m6A methylation in endometriosis remain unknown. Thus, in the present study, we investigated the differential m6A methylation levels in paired ectopic and eutopic endometria and predicted the functions of m6A methylation using bioinformatics analysis. Furthermore, we detected the expression of m6A regulator genes and explored the function of METTL3/METTL14 in endometrial cells. Our findings will help provide new insights into the pathogenesis of endometriosis.

      MATERIALS AND METHODS

      Ethical approval and informed consent

      This study was approved on 24 October 2019 by the Medical Ethics Committee of Xiangya Hospital, Central South University, no. 201910255, and written informed consent was obtained from all subjects.

      Sample collection

      Eighteen female patients with ovarian endometriomas between the age of 23 and 47 were enrolled (Table 1). The average body mass index was 20.56 ± 2.31 kg/m2, and all the participants had and regular menstrual cycles. They were received gynecological surgery for detected ovarian cyst range from 0.2 to 7 years, and 8 cases were diagnosed of bilateral ovarian endometriomas and 10 of unilateral endometriomas by surgical exploration. None of them took steroid hormone medications in latest 3 months. Subsequently, paired ectopic endometrium (EC) and eutopic endometrium (EU) were collected in the proliferative phase from each patient. Endometriosis was pathologically diagnosed and staged at stage III–IV using the revised American Fertility Society staging system, with 10 cases in at stage III and 8 at stage IV.
      Table 1Clinical characteristics of 18 patients with endometriosis
      ItemsPatient variables
      Age32.56±7.55
      BMI20.56±2.51
      Disease course0.2-7 years
      Phase of menstrual cycleproliferation
      Location of endometriosis
       unilateral ovarian endometriomas10
       bilateral ovarian endometriomas8
      Stage
       III10
       IV8

      RNA Extraction

      First, eighteen paired EC and EU tissues were homogenized in 1 ml of TRIzol (Invitrogen, USA), and total RNA was isolated with 0.2 ml of chloroform. Then, RNA was precipitated with 0.5 ml of isopropanol, washed with 75% ethanol, and dissolved in an appropriate volume of RNase-free water. Finally, RNA concentration and purity were determined using a NanoVue Plus spectrophotometer (Healthcare Bio-Science AB, Uppsala, Sweden), and RNA integrity was accessed using denaturing agarose electrophoresis.

      m6A-mRNA Epitranscriptomic Microarray

      Paired EC and EU tissues for microarray were collected from 3 patients who had the disease duration of 1 to 7 years, with two at stage III and one at stage IV, two bilateral endometrioma and one unilateral endometrioma. Total RNA was incubated with an anti-m6A antibody (Synaptic Systems). The m6A-methylated RNAs were eluted from the immunoprecipitated magnetic beads (the IP fraction), and unmodified RNAs were obtained from the supernatant (the Sup fraction). The IP and Sup RNAs were amplified as cRNAs and labeled with Cy5 and Cy3, respectively, using an Arraystar Super RNA Labeling Kit. The labeled cRNAs were hybridized onto an Arraystar Human mRNA&lncRNA Epitranscriptomic Microarray (8 × 60K; Arraystar, USA) at 65°C for 17 h in an Agilent Hybridization Oven. After washing, the arrays were scanned with an Agilent Scanner G2505C.

      Bioinformatic analysis

      Acquired array images were analyzed using the Agilent Feature Extraction software (version 11.0.1.1). The raw intensity of the Cy5-labeled IP cRNAs and the Cy3-labeled Sup cRNAs was normalized to the average log2-scaled intensity of the spiked-in RNA. Then, the probe signals with a present (P) or marginal (M) QC flags in at least 1 out of the three paired samples were reserved for further analysis. The percentage of m6A modification was calculated as the m6A methylation level based on the normalized intensities of the IP and Sup, and the m6A quantity was counted based on the normalized intensities of IP. The RNA level was calculated based on the total IP (Cy5-labelled) and Sup (Cy3-labelled) normalized intensities, and an additional quantile normalization method of limma package was used to normalize the RNA expression level between arrays before probes flag screening. The hierarchical clustering analysis was performed using the R software on all detected RNA based on the similarities of their m6A methylation quality or mRNA expression level, of which the closeness of their relationships was displayed on top of the heatmaps. The differentially m6A-methylated or expressed RNAs in the EC and EU were determined by filtering with the fold change and statistical thresholds. Gene ontology (GO) analyzed differentially m6A-methylated or expressed mRNAs using topGO package in R environment. KEGG pathway analysis were performed to explore the potential biological pathways of differentially m6A-methylated or expressed mRNAs by fisher's exact test.

      Evaluation of candidate mRNA with qRT-PCR

      Total RNA from eighteen paired EC and EU was extracted from paired EC and EU tissues using TRIzol and quantified using a NanoVue Plus spectrophotometer (Healthcare Bio-Science AB). The reverse transcriptional reaction was done using a reverse transcriptase kit (TaKaRa, China), and PCR was done using the SYBR Green qPCR Mix (Bio-Rad, USA) and specific primer sets (Table 2) on an Applied Biosystems 7900 Real-Time PCR system. The experiments were performed in triplicates, and relative mRNA levels were analyzed using the 2−ΔΔCt method.
      Table 2Primers for qRT-PCR
      PrimersSequence (5′ - 3′)
      METTL3-FCTGGGCACTTGGATTTAAGGAA
      METTL3-RTGAGAGGTGGTGTAGCAACTT
      METTL14-FGAGCTGAGAGTGCGGATAGC
      METTL14-RGCAGATGTATCATAGGAAGCCC
      WTAP-FTTGTAATGCGACTAGCAACCAA
      WTAP-RGCTGGGTCTACCATTGTTGATCT
      RBM15-FGTGAGGACTCGACTTCCCG
      RBM15-RGCCGCTATCGGTCTTTCCG
      MMP2-FGATACCCCTTTGACGGTAAGGA
      MMP2-RCCTTCTCCCAAGGTCCATAGC
      NCOA1-FAATGAATACGAGCGTCTACAGC
      NCOA1-RTTTCGTCGTGTTGCCTCTTGA
      TLR4-FTGCCTCTCTTGCATCTGGCTGG
      TLR4-RCTGTCAGTACCAAGGTTGAGAGCTGG
      PPP2R2D-FGTCAAGGACAGGGCAGACTTC
      PPP2R2D-RAGCTGTTCTCAGCTGTTCTATCA
      YWHAZ-FCTCTCTTGCAAAGACAGCTTTT
      YWHAZ-RGTCCACAATGTCAAGTTGTCTC
      GAPDH-FTGCACCACCAACTGCTTAGC
      GAPDH-RGGCATGGACTGTGGTCATGAG

      Immunohistochemical staining

      Eighteen paired EC and EU tissue sections were dewaxed and rehydrated. Antigen retrieval was conducted in sodium citrate solution (0.01 M) at 98°C for 15 min, endogenous peroxidase was blocked with hydrogen peroxide (3%) at room temperature for 20 min, and then the sections were blocked in fetal bovine serum (10%) for 1 hour. Subsequently, the slices were incubated with primary antibody against MMP2 (1:200; Poteintech), NCOA1 (1:200; ABclonal), PPP2R2D (1:200; Biosss), YWHAZ (1:200; Proteintech), METTL3 (1:500; Abcam), and METTL14 (1:200; ABclonal) at 4°C overnight. After rewarm at 37°C, secondary antibody was added and incubated at room temperature for 1 hour. Finally, the sections were colored with dimethylaminoazobenzene (DAB) and counterstained with hematoxylin. Five fields were observed under high power from every immunostained section and the positive signals were counted.

      MeRIP-qPCR

      First, 1–3 μg of total RNA from eighteen paired EC and EU and a spiked-in control mixture for m6A were added to 300 μl of IP mixture containing 3 μl of RNase inhibitor (Enzymatics) and 2 μl of anti-m6A rabbit polyclonal antibody (Synaptic Systems). After the reaction was incubated at 4°C for 2 h, 20 μl of Dynabeads™ M-280 sheep anti-rabbit IgG (Invitrogen) per sample with 0.5% BSA was added to incubate at 4°C for 2 h, washed with 300 μl of IP buffer twice, re-suspended in the anti-m6A antibody mixture prepared above, and incubated overnight. After the EP tube was placed on a magnetic bead stand for 10 min to allow the beads to attach to the tube wall, the beads were washed with 500 μl of IP buffer three times and eluted with 200 μl of elution buffer at 50°C for 1 h. Then, the isolated co-precipitated RNA was used for qPCR as described above with the primers for three m6A-enriched genes MMP2 (forward primer 5′-GGATGATGCCTTTGCTCG-3′ and reverse primer 5′-ATCGGCGTTCCCATACTT-3′), NCOA1 (5′-CAGCTTCACTTCAGTCCGC-3′ and 5′-CTTTGCCACTAAGGAAGGATA-3′), and TLR4 (5′-CAGGATGAGGACTGGGTAAGGA-3′ and 5′-ATGGAGGCACCCCTTCTTCTA-3′).

      Cell culture and transfection

      Eutopic endometrial tissues for cell culture were collected from 3 patients who had the disease duration of 1 to 2 years, with two at stage III and one at stage IV, one bilateral endometrioma and two unilateral endometrioma. Tissues were cut into pieces and digested with collagenase and then DNase I. After filtration through a 70-μm cell strainer, endometrial stromal cells were collected and cultured in F12/DMEM with 10% fetal bovine serum in an incubator with 5% CO2 at 37°C. siRNA-targeted human METTTL3 or METTL14 (RiboBio, Guangzhou, China) was transfected into the cells using Lipofectamine 2000 (Invitrogen, USA). The siRNA-targeted human METTTL3 included METTL3 siRNA-1(5′-CAAGTATGTTCACTATGAA-3′), siRNA-2(5′-GACTGCTCTTTCCTTAATA-3′) and siRNA-3(5′-GGACTCGACTACAGTAGCT-3′). The siRNA-targeted human METTTL14 included METTL14 siRNA-1 (5′-GGATGAAGGAGAGACAGAT-3′), siRNA-2 (5′-TATCGGCTTGTAAGTACAT-3′), and siRNA-3 (5′-GGACCAACGCTTACAAATA-3′). After 48 h, the cells were then harvested for subsequent experiments. All experiments were performed in three biological replicates, with three technical replicates in each experiment.

      Cell viability assay

      The primary eutopic stromal cells seeded in 96-well culture plates at 10,000 cells/well were transfected with 50 nm si-METTL3 shRNA, si-METTL14 shRNA or shNC (Guangzhou Ruibo Biotechnology Inc., Guangzhou, China) and 1 × 10−7 mmol/L estradiol. After incubation for 48 h, the cells were treated with 10 μl of Cell Counting Kit-8 (CCK-8) solution (Med Chem Express, NJ, USA). The OD value of each well was measured at 450 nm and recorded by Infinite M200 PRO (Tecan, Grödig, Austria).

      Transwell migration and Matrigel invasion assays

      Transwell migration and Matrigel invasion assays were performed using Transwell chambers and 8mm polycarbonate filters (Discovery Labware Inc., Bedford, MA, USA). The eutopic stromal cells were transfected with si-METTL3 shRNA, si-METTL14 shRNA or shNC for 48 h and suspended in 200 µl of serum-free DMEM/F-12 (Gibco) at 2 × 104 and 2 × 105 cells/l for the transwell migration and Matrigel invasion assay, respectively. Each experimental parameter was set up in duplicates. Afterward, the suspended cells were seeded into the top chambers with or without a Matrigel coating (BD Biosciences, USA). Meanwhile, 700 µl of DMEM/F-12 with 10% FBS (Gibco) was placed into the bottom chambers.
      After incubation at 37°C for 24 h(migration assay) or 48 h (invasion assay), the cells remaining on the membrane surface were removed. Subsequently, the cells were washed with PBS twice, and methanol was added to the upper and lower chambers for 20 min. Next, the cells were stained with 0.1% crystal violet for 15 min and examined under an optical microscope (200 × magnification). Finally, the cells migrating through the membrane and the cells invading the Matrigel were randomly selected from each chamber and counted in five non-overlapping 200 × fields under a light microscope using ImageJ software.

      In vitro scratch assay

      The eutopic stromal cells at 1 × 105/well were seeded into 6-well plates. After 24 h, an incision was made on the cell plates with a 200-μl sterile pipette tip, and the cells were treated with si-METTL3 shRNA, si-METTL14 shRNA or shNC. The migration of the cells to the incision was observed under an inverted microscope after 48 h. The distances between the incision areas were measured using ImageJ.

      Western blot

      The GAPDH antibody (WL01114; WanleiBio) (1:500) was used for normalization, as multiple laboratories have shown that GAPDH has been securely expressed in endometrial stromal cells. The polyclonal rabbit IgG antibody against human NCOA1 (51114-1-AP; ProteinTech), polyclonal rabbit IgG antibody against human MMP2 (10373-2-AP; ProteinTech), polyclonal rabbit antibody against human PPP2R2D (bs-19968P; Biosss), polyclonal rabbit IgG antibody against human YWHAZ (14881-1-AP; Proteintech), were diluted at 1:1000. The secondary antibody (M21007; Abmart) was applied at 1:5,000.

      Statistical analysis

      Statistical analysis was done using SPSS 25.0 and GraphPad Prism 9.0. The data were presented as mean ± standard deviation. Two-tailed Student's t-tests were used for pairwise comparisons, and one-way ANOVA analysis for comparisons among multiple groups. Statistical significance was set at a P-value (two-sided) of <0.05.

      Results

      Differential profiles and potential roles of m6A methylation in endometriosis

      We performed m6A–mRNA epitranscriptomic microarray with the tissues from paired EC and EU. Hierarchical clustering showed differential mRNA methylation levels in the EC and EU tissues (Figure 1A). In addition, volcano plots displayed mRNAs with differentially methylated levels (Figure 1B). The methylation levels were downregulated in 1,312 mRNAs and upregulated in 518 mRNAs in the EC compared with the EU; thus, there were more hypo-methylated genes in the EC.
      Figure 1
      Figure 1Characterization and bioinformatic analysis of m6A methylation in endometriosis. (A) The hierarchical clustering of the mRNA methylation levels in paired ectopic endometrium (EC) and eutopic endometrium (EU). (B) The volcano plots of the 1,312 mRNAs with downregulated methylation levels and 518 mRNAs with upregulated methylation levels in the EC compared with the EU. The red and blue plots indicate statistically significant change in the mRNA methylation level based on |FC| ≥1.5 and P-values ≤ 0.05. (C) The top 10 GO terms of genes with hyper-m6A methylation levels. (D) The top 10 GO terms of genes with hypo-m6A methylation levels. (E) The KEGG pathways of genes with hyper-m6A methylation levels. (F) The KEGG pathways of genes with hypo-m6A methylation levels. All samples were assayed in triplicate.
      Moreover, GO and KEGG pathway analyses were performed to investigate the biological function of m6A modification in endometriosis. The top 10 enriched biological processes, cellular components, and molecular function genes with hyper-methylated and hypo-methylated m6A were identified (Figure 1C and D, respectively). The top clusters of biological functions were mainly related to stem cell differentiation and the cell cycle. The pathways of the genes with hyper-methylated and hypo-methylated m6A in endometriosis were revealed (Figure 1E and F, respectively). The genes with hyper-methylated m6A were enriched in the pathways related to the transcriptional dysregulation in cancer and ether lipid metabolism. Meanwhile, the genes with hypo-methylated m6A were significantly associated with the estrogen signaling pathway, Hippo signaling pathway, PI3K–Akt signaling pathway and adherens junction pathway in endometriosis. These data revealed distinct differences in the m6A methylation profiles between the EC and EU, suggesting that the genes with hypo-methylated m6A might be related to the pathogenesis of endometriosis.

      Conjoint analysis of the m6A methylation profile and mRNA transcription

      Hierarchical clustering uncovered differentially expressed mRNAs in the EC and EU (Figure 2A). The volcano plot exhibited 1,797 upregulated mRNAs and 2,580 downregulated mRNAs in the EC compared to the EU (Figure 2B), indicating that more genes were downregulated in the EC. In addition, we conducted a conjoint analysis of the m6A methylation and mRNA levels. There is a significant enrichment of methylated RNA in differentially expressed genes by chi square test (P<0.001). The four-quadrant plot displayed the distribution of differential genes in both mRNA and m6A methylation levels (Figure 2C); 154 upregulated mRNAs were m6A hyper-methylated (hyper-up, upper right, orange), and 659 upregulated mRNAs were m6A hypo-methylated (hypo-up, lower right, pink), whereas 220 downregulated mRNAs were m6A hyper-methylated (hyper-down, upper left, green), and 697 downregulated mRNAs were m6A hypo-methylated (hypo-down, lower left, blue). The conjoint analysis results indicated that there were more hypo-methylated and upregulated (hypo-up) genes (659) than hyper-methylated and downregulated (hyper-down) genes (220) in the EC.
      Figure 2
      Figure 2Conjoint analysis of m6A methylation levels and mRNA transcription. (A) The hierarchical clustering of the mRNA levels in EC and EU. (B) The volcano plots of 1,797 upregulated mRNAs and 2,580 downregulated mRNAs in the EC compared with the EU. The red and blue plots indicate statistically significant change in the mRNA level based on |FC| ≥1.5 and P-values ≤ 0.05. (C) The four-quadrant plots of the distribution of genes with significant changes in both mRNA and m6A methylation levels. Upper right quadrant: hyper-up, orange; lower right quadrant: hypo-up, pink; upper left quadrant: hyper-down, green; lower left quadrant: hypo-down, blue. All samples were assayed in triplicate.

      Validation of the m6A methylation level and expression of genes

      Validation was performed on MMP2, NCOA1, TLR4, PPP2R2D and YWHAZ, five genes included in the conjoint analysis of hypo-methylated m6A and upregulated gene expression. MMP2, NCOA1, TLR4 were enriched in estrogen signaling, whilePPP2R2D and YWHAZ were enriched both in Hippo and PI3K-Akt signaling pathways. The m6A methylation levels were examined using MeRIP-qPCR (Figure 3A). There was no significant difference in the m6A methylation of the TLR4 mRNA in the EC and EU. However, the m6A methylation of the MMP2 mRNA significantly decreased by 38.5% (P < 0.05), and that of the NCOA1 mRNA decreased by 59.6% (P < 0.05) in the EC compared with the EU. The mRNA levels were measured using qPCR (Figure 3B). Compared with those in the EU, the mRNA levels of MMP2 and NCOA1 in the EC were significantly upregulated by 2.82- and 2.98-fold, respectively (P < 0.05); while that of TLR4 had no significant difference between two groups. MMP2 was positive mainly in the nucleus, with higher expression in EC compared to paired EU. NCOA1 was positive mainly in the cytoplasm, with a higher level in EC than that in paired EU. And PPP2R2D and YWHAZ were both positive in the cytoplasm and nucleus, with a higher level in EC than that in paired EU (Figure 3C).
      Figure 3
      Figure 3Validation of the m6A methylation level and mRNA level of the genes enriched in estrogen signaling. (A) The m6A methylation level of MMP2, NCOA1, TLR4, PPP2R2D and YWHAZ in the ectopic endometrium (EC, black bar) and eutopic endometrium (EU, hatched gray bar) was validated using MeRIP-qPCR. (B) The expression of MMP2, NCOA1, TLR4, PPP2R2D and YWHAZ in the EC (black bar) and EU (hatched gray bar) using qRT-PCR. (C) Immunohistochemistry was performed to assess the protein levels of MMP2, NCOA1, PPP2R2D and YWHAZ in the EC and EU; magnification, × 200. Two-tailed Student's t-tests were used for comparisons between EC and EU. All samples were assayed in triplicate. * indicate statistical significance (P <0.05).

      Differential expression of METTL3 and METTL14 in the ectopic endometrium and eutopic endometrium

      The expression of METTL3, METTL14, WTAP and RBM15 was detected using qPCR. The expression of METTL3 and METTL14 significantly decreased by 70.6% and 63.2%, respectively, in the EC compared to the EU (Figure 4A). However, there were no significant differences in the expression of WTAP and RBM15. By immunohistochemistry, both METTL3 and METTL14 protein were positive mainly in the nucleus, with a higher level in EC than that in paired EU (Figure 4B).
      Figure 4
      Figure 4The expression levels of m6A writers in the ectopic endometrium and eutopic endometrium. (A) The mRNA expression levels of METTL3, METTL14, WTAP and RBM15 by qPCR. (B) The protein expression levels of METTL3 and METTL14 by Immunohistochemistry staining; magnification, × 200. Two-tailed Student's t-tests were used for comparisons between EC and EU. All samples were assayed in triplicate. * indicate statistical significance (P <0.05).

      Downregulation of METTL3/METTL14 promotes cell proliferation, migration and invasion

      Next, we investigated the role of METTL3 and METTL14 in cell proliferation and invasion. We treated endometrial stromal cells with si-METTL3 and si-METTL14. qPCR and Western blotting assays demonstrated that the expression of NCOA1, MMP2, PPP2R2D and YWHAZ was increased after METTL3 and METTL14 knockdown (Figure 5 A, B). CCK-8 assay showed that METTL3 or METTL14 knockdown promoted cell proliferation; this result was enhanced by both METTL3 and METTL14 knockdown (Figure 5C). Similarly, cell migration was increased after METTL3 or METTL14 knockdown and enhanced by both METTL3 and METTL14 knockdown. The migration ability of endometrial stromal cells was further examined using the starch assay (Figure 5D). Lastly, Trans-well assay results indicated that METTL3 or METTL14 knockdown promoted the invasion and migration of endometrial stromal cells; this result was reinforced by both METTL3 and METTL14 knockdown (Figure 5E).
      Figure 5
      Figure 5Knockdown of METTL3 and (or) METTL14 contributes to the cellular phenotype of endometriosis. (A–B) qPCR and Western blotting analysis of the expression of NCOA1, MMP2 PPP2R2D and YWHAZ after the knockdown of METTL3 and(or) METTL14. Cell viability assay of the cells with METTL3 and METTL14 knockdown. (C) The CCK-8 assay of the cell viability after the knockdown of METTL3 and METTL14. (D) The scratch assay of the cell migration after the knockdown of METTL3 and METTL14. (E) Transwell assay of the effect of the METTL3 and METTL14 knockdown on the invasion and migration of endometrial stromal cells. NC: negative control; si-METTL14 was transfected with siMETTL14; si-METTL3 was transfected with siMETTL3; si-METTL3+si-METTL14 were transfected with si-METTL3 and si-METTL14. All samples were assayed in triplicate. * indicate statistical significance (P <0.05).

      Discussion

      Studies of endometriosis have suggested several important models for the induction of endometriotic growth in the pelvis. For example, because of increased local E2 concentrations in the EC, the activation of the estrogen signaling pathway has been thought to play a crucial role in endometriosis progression. The m6A modification, one of the most crucial modifications on eukaryote mRNAs, may regulate the endometriotic progression. However, the m6A–mRNA epitranscriptomic profile and the exact molecular mechanism requires clarification.
      In the present study, we performed m6A–mRNA epitranscriptomic microarray and found more hypo-methylated genes in the EC than in the EU. In addition, the m6A methylation and mRNA transcription conjoint analysis identified more hypo-methylated with upregulated (hypo-up) genes in the EC. Moreover, pathway analysis revealed that the genes with hypo-methylated m6A were significantly associated with the estrogen signaling pathway, Hippo signaling pathway, PI3K–Akt signaling pathway, CAMs, and adherens junction. These results are consistent with the reported association between estrogen signaling dysregulation and endometriosis (Han et al., 2015; Marquardt et al., 2019; Vercellini et al., 2014; Zhou et al., 2016). In addition, the functions of steroid receptors are regulated by steroid receptor coactivators (SRCs), comprising SRC-1, SRC-2, and SRC-3 (Marquardt et al., 2019). SRC-1 and SRC-2, encoded by NCOA1 and NCOA2, respectively, are the most significant regulators in the endometrium; SRC-1 is mainly involved in E2 signaling, and SRC-2 in progesterone functions (Shi et al., 2014; Marquardt et al., 2019). Moreover, the activation of PI3K–Akt signaling promotes endometriotic lesion growth by upregulating Erβ (Zhou et al., 2016). In addition, Hippo signaling enhances cell proliferation and apoptosis; inhibiting the pathway decreases cell proliferation and apoptosis and reduces endometriotic lesions in a nude mice endometriosis model (Song et al., 2016). Meanwhile, aberrant cell adhesion is thought to be a crucial initiation of the growth of the EC (Tsai et al., 2018). Our results suggested that m6A methylation might play a role in endometriosis via the post-transcriptional regulation of those critical pathways.
      We further verified the hypomethylation of NCOA1, MMP2, PPP2R2D and YWHAZ mRNA, corresponding with the upregulation of their mRNA levels. Matrix metallopeptidase 2 (MMP2) is related to high estrogen levels and promotes cell invasion and metastasis in breast carcinoma (Di et al., 2005). In addition, MMP2 expression in the endometrium is increased under estrogen stimulation (Li et al., 2018; Li et al., 2019) and involved in the migration and invasion of endometrial cells in endometriosis (Li et al., 2018). Increased expression of YWHAZ in endometriosis enhances cell proliferation (Joshi et al., 2015). Upregulated PPP2R2D in gastric cancer promoted cell proliferation and migration, and is positively correlated with tumor stage (Yu et al., 2018).  Thus, NCOA1, MMP2, PPP2R2D and YWHAZ which would be activated by m6A hypomethylation may contribute to the pathogenesis of endometriosis.
      The aberrant m6A methylation levels are related to the aberrant expression of genes encoding m6A regulators. Additionally, m6A is produced by the methyltransferase complex, which is in the nucleus and composed of METTL3, METTL14, WTAP, and RBM15 (Zaccara et al., 2019; Huang et al., 2021). Furthermore, METTL3 and METTL14 form a heterodimeric complex and cooperatively function as the central m6A writers. METTL14 recognizes and binds to RNA substrates, which structurally activates the catalytical activity of METTL3. (Zaccara et al., 2019; Huang et al., 2021). Thus, we measured the expression level of both METTL3 and METTL14 in paired EC and EU tissues. METTL3 and METTL14 was validated to be significantly downregulated in EC Compared with the EU, consistent with a previous database analysis (Jiang et al., 2020).
      METTL3 acts as the core catalytic enzyme in m6A modification; whereas METTL14, with a high binding affinity to target RNAs, acts as an activator of METTL3 (Zaccara et al., 2019). Dysregulation of METTL3 and METTL14 may plays an important role in tumorigenic processes via epitranscriptomic mechanisms (Liu et al., 2021). However, the function of METTL3 and METTL14 in endometriosis remains unknown.
      In our study, downregulated METTL3 and METTL14 promoted stromal cell proliferation, and migration and invasion in the EU. Thus, the data reflected the biological functions of m6A writers in endometriosis. For example, the expression of NCOA1, MMP2, PPP2R2D and YWHAZ was found to be significantly increased after the knockdown of METTL3 and METTL14, implying that METTL3 and METTL14 played a vital role in endometriosis by modulating the m6A methylation of related genes. Additionally, SRC-1, encoded by NCOA1, enhances the invasion of endometriotic epithelial cells via its cooperative interactions with Erβ to enable the implantation of endometriotic lesions (Han et al., 2015). Moreover, MMP2 is involved in the estrogen-related ectopic growth of the endometrium (Wang and Ma, 2012). PPP2R2D and YWHAZ are implicated in cell proliferation and migration (Joshi et al., 2015; Yu et al., 2018).  These data indicated that downregulation of METTL3 and METTL14 promoted the growth and infiltration of endometriotic lesions into extra uterine organs by modulating m6A methylation levels of several genes associated with the estrogen signaling pathway. Further investigations are needed to clarify the specific mechanism in modulating the target genes in endometrial cells in endometriosis.
      In summary, the present study profiled the m6A methylation pattern and the expression of m6A regulator genes in endometriosis. We found more hypo-methylated and upregulated genes in the EC. Bioinformatic analysis indicated a role of potential post-transcriptional modulation in the pathogenesis of endometriosis. Furthermore, we observed that the downregulation of METTL3 and METTL14 contributed to the proliferation, invasion, and migration of endometrial stromal cells in endometriosis. The main limitation of the study is the small specimen number with no normal endometrium as a control. And on the other hand, we only enrolled specimens from ovarian endometriosis in proliferative phase; thus, the results cannot be extrapolated to other types of endometriosis or those in secretory phase. A larger sample size with a wide range of types endometriosis would help to improve the validity for subsequent analysis and verification. In addition, further exploration the mechanism and regulatory pattern of m6A methylation in an animal model could be a productive issue for future research in endometriosis.

      Data availability statement

      All data generated or analysed during this study are included in this published article, or they are available from the corresponding author on reasonable request.

      ACKNOWLEDGEMENTS

      We would like to express our gratitude to all the patients and control group participants in the research. This work was supported by grants from the National Natural Science Foundation of China (No. 81801426) and Natural Science Foundation of Hunan Provincie (No.2022JJ30955 & No. 2022JJ40839).

      Authors' roles

      YWY and CZ performed the experiments and analyzed the data. YWY wrote the manuscript. YZ conceived and supervised the study. LCS obtained funding, designed the research plan, and revised the manuscript. All authors read and approved the final manuscript.

      ***References

      Liu et al., 2022 L. Liu, H. Li, D. Hu, Y. Wang, W. Shao, J. Zhong, S. Yang, J. Liu, J. Zhang Insights into N6-methyladenosine and programmed cell death in cancer Mol.Cancer., 21(2022), pp.32, 10.1186/s12943-022-01508-w
      Di et al., 2005 G.H. Di, J.S. Lu, C.G. Song, H.C. Li, Z.Z. Shen, Z.M. Shao Over expression of aromatase protein is highly related to MMPs levels in human breast carcinomas J.Exp.Clin.Cancer.Res., 24(2005), pp.601-607
      Dong et al., 2021 L.H. Dong, C.Y. Chen, Y.W. Zhang, P.J Guo, Z.H. Wang, J. Li, Y. Liu, J. Liu, R.B. Chang, Y.L. Li, G.H. Liang, W.Y. Lai, M.X. Sun, U. Dougherty, M. B. Bissonnette, H.L. Wang, L. Shen, M.M. Xu, D.L. Han The loss of RNA N-adenosine methyltransferase Mettl14 in tumor-associated macrophages promotes CD8 T cell dysfunction and tumor growth Cancer Cell., 39(2021), pp.945-957.e910, 10.1016/j.ccell.2021.04.016
      Eisenberg et al., 2018 V.H. Eisenberg, C. Weil, G. Chodick, V.Shalev Epidemiology of endometriosis: a large population-based database study from a healthcare provider with 2 million members BJOG., 125(2018), pp.55-62, 10.1111/1471-0528.14711
      Fu et al., 2014 Y. Fu, D. Dominissini, G. Rechavi, C. He Gene expression regulation mediated through reversible m⁶A RNA methylation Nat.Rev.Genet., 15(2014), pp.293-306, 10.1038/nrg3724
      Han et al., 2015 S.J. Han, S.Y. Jung, S.P. Wu, S.M Hawkins, M.J. Park, S. Kyo, J. Qin, J. P. Lydon, S.Y. Tsai, M.J. Tsai, F.J. DeMayo, B. W. O'Malley Estrogen Receptor β Modulates Apoptosis Complexes and the Inflammasome to Drive the Pathogenesis of Endometriosis Cell., 163(2015), pp.960-974, 10.1016/j.cell.2015.10.034
      Huang et al., 2021 W. Huang, T.Q. Chen, K. Fang, Z.C. Zeng, H. Ye, Y.Q. Chen N6-methyladenosine methyltransferases: functions, regulation, and clinical potential J.Hematol.Oncol., 14(2021), pp.117, 10.1186/s13045-021-01129-8
      Jiang et al., 2020 L. Jiang, M.M. Zhang, J.N. Wu, S.X. Wang, X. Yang, M.Y. Yi, X.Y. Zhang, X.L. Fang Exploring diagnostic m6A regulators in endometriosis Aging., 12(2020), pp.25916-25938, 10.18632/aging.20216
      Jiang et al., 2021 X.L. Jiang, B.Y. Liu, Z.Nie, L.C Duan, Q.X. Xiong, Z.X. Jin, C.P. Yang, Y.B. Chen The role of m6A modification in the biological functions and diseases Signal. Transduct. Target. Ther., 6(2021), pp.74, 10.1038/s41392-020-00450-x
      Joshi et al., 2015 Joshi NR, Su RW, Chandramouli GV, Khoo SK, Jeong JW, Young SL, Lessey BA, Fazleabas AT Altered expression of microRNA-451 in eutopic endometrium of baboons (Papio anubis) with endometriosis. Hum. Reprod., 30(2015), pp.2881-2891, 10.1093/humrep/dev229.
      Li et al., 2018 Y. Li, X.Y. Wang, X.S. Wang, L. Wan, Y.P Liu, Y.Y. Shi PDCD4 suppresses proliferation, migration, and invasion of endometrial cells by inhibiting autophagy and NF-κB/MMP2/MMP9 signal pathway Biol. Reprod., 99(2018), pp.360-372, 10.1093/biolre/ioy052
      Li et al., 2019 M.Y. Li, L.H Yao, M.Z Xin, M.Z. Gao Dysregulation of collagen expression in peri-implantation endometrium of women with high ovarian response J. Obstet. Gynaecol. Res., 45(2019), pp.1035-1044, 10.1111/jog.13936
      Liu et al., 2021 P.Y Liu, F.M Li, J.H Lin, T. Fukumoto, T. Nacarelli, X. Hao, A.V. Kossenkov, M.C. Simon, R. Zhang m6A-independent genome-wide METTL3 and METTL14 redistribution drives the senescence-associated secretory phenotype Nat. Cell. Biol., 23(2021), pp. 355-365, 10.1038/s41556-021-00656-3
      Livneh et al., 2020 I. Livneh, S.M. Moshkovitz, N. Amariglio, G. Rechavi, D. Dominissini The m6A epitranscriptome: transcriptome plasticity in brain development and function Nat. Rev. Neurosci., 21(2021), pp.36-51, 10.1038/s41583-019-0244-z
      Marquardt et al., 2019 R.M. Marquardt, T.H. Kim, J.H. Shin, J.W. Jeong Progesterone and Estrogen Signaling in the Endometrium: What Goes Wrong in Endometriosis? Int.J.Mol.Sci., 20(2019), pp.3822, 10.3390/ijms20153822
      Vercellini et al., 2014 P. Vercellini, P. Viganò, E. Somigliana, L. Fedele Endometriosis: pathogenesis and treatment Nat.Rev.Endocrinol., 10(2014), pp.261-275, 10.1038/nrendo.2013.255
      Shi et al., 2014 X. Shi, W. Xu, H.H. Dai, Y. Sun, X.L. Wang The role of SRC1 and SRC2 in steroid-induced SDF1 expression in normal and ectopic endometrium Reproduction., 147(2014), pp. 847-853, 10.1530/REP-14-0027
      Song et al., 2016 Y. Song, J. Fu, M. Zhou, L. Xiao, X. Feng, H Chen, W. Huang Activated Hippo/Yes-Associated Protein Pathway Promotes Cell Proliferation and Anti-apoptosis in Endometrial Stromal Cells of Endometriosis J.Clin.Endocrinol.Metab., 101(2016), pp.1552-1561, 10.1210/jc.2016-1120
      Taylor et al., 2021 H.S. Taylor, A.M. Kotlyar, V.A. Flores Endometriosis is a chronic systemic disease: clinical challenges and novel innovations Lancet., 397(2021), pp.839-852, 10.1016/S0140-6736(21)00389-5
      Tsai et al., 2018 H.W. Tsai, M.T. Huang, P.H. Wang, B.S. Huang, Y.J. Chen, S.L. Hsieh Decoy receptor 3 promotes cell adhesion and enhances endometriosis development J.Patho., 244(2018), pp.189-202, 10.1002/path.5000
      Wang and Ma, 2012 J. Wang, X. Ma Effects of estrogen and progestin on expression of MMP-2 and TIMP-2 in a nude mouse model of endometriosis Clin. Exp. Obstet. Gynecol., 39(2012), pp.229-233.
      Wang et al., 2014 X. Wang, Z. Lu, A. Gomez, G.C. Hon, Y. Yue, D. Han, Y. Fu, M. Parisien, Q. Dai, G. Jia, B. Ren, T. Pan, C. He N6-methyladenosine-dependent regulation of messenger RNA stability Nature., 505(2014), pp.117-120, 10.1038/nature12730
      Wang et al., 2015 X. Wang, B.S. Zhao, I.A. Roundtree, Z. Lu, D. Han, H. Ma, X. Weng, K. Chen, H. Shi, C. He N(6)-methyladenosine Modulates Messenger RNA Translation Efficiency Cell., 161(2015), pp.1388-1399, 10.1016/j.cell.2015.05.014
      Wang et al., 2020 Y. Wang, K. Nicholes, I.M. Shih The Origin and Pathogenesis of Endometriosis Annu. Rev. Pathol., 15(2020), pp.71-95, 10.1146/annurev-pathmechdis-012419-032654
      Wiener and Schwartz, 2021 D. Wiener, S. Schwartz The epitranscriptome beyond m6A Nat. Rev. Genet., 22(2021), pp.119-131, 10.1038/s41576-020-00295-8
      Yang et al., 2018 Y. Yang, P.J. Hsu, Y.S. Chen, Y.G. Yang Dynamic transcriptomic m6A decoration: writers, erasers, readers and functions in RNA metabolism Cell.Res., 28(2018), pp.616-624, 10.1038/s41422-018-0040-8
      Yu et al., 2018 Yu S, Li L, Wu Q, Dou N, Li Y, Gao Y PPP2R2D, a regulatory subunit of protein phosphatase 2A, promotes gastric cancer growth and metastasis via mechanistic target of rapamycin activation. Int. J. Oncol. 52(2018), pp.2011-2020, 10.3892/ijo.2018.4329.
      Zaccara et al., 2019 S. Zaccara, R.J. Ries, S.R. Jaffrey Reading, writing and erasing mRNA methylation Nat. Rev. Mol. Cell. Biol., 20(2019), pp.608-624,10.1038/s41580-019-0168-5
      Zhou et al., 2016 Y. Zhou, C. Zeng, X. Li, P.L. Wu, L. Yin, X.L. Yu, Y.F. Zhou, Q. Xue IGF-I stimulates ERβ and aromatase expression via IGF1R/PI3K/AKT-mediated transcriptional activation in endometriosis J. Mol. Med., 94(2016), pp.887-97,10.1007/s00109-016-1396-1

      Data Availability

      • Data will be made available on request.

      Biography

      Yongwen Yang, who received his master's degree Wuhan university,China, is a lead technician in clinical laboratory of The Xiangya Hospital of Central South University, He mainly focuses on basic and clinical research into endometriosis and adenomyosis.
      KEY MESSAGE
      A total of 1312 mRNAs were identified dysregulating the m6A methylation levels.Pathway analysis found the genes were significantly associated with estrogen, Hippo, and PI3K–Akt signaling and cell–cell adhesion. METTL3 and METTL14 knockdown caused cell proliferation and invasion in the pathogenesis and progression of endometriosis.